For in-depth product & services help, ask our
Technical Information Scientists
This genotyping assay uses pyrosequencing technology and is run on the Biotage PSQ 96MA. The Jackson Laboratory is not posting the complete details of our pyrosequencing genotyping assays as the primers for pyrosequencing cannot be used for sequencing using more traditional methods. The wild type and mutant nucleotides and the flanking DNA sequence are provided below.
GGCTGGCCACCCACCTAGCCATAGCTGCTCCACTACACTACTCAGAGGCTATTTTCCTACCATTTCCTCTCTCTTG
GCTTATAGGGTCCACCTGGCCCTGTTGGTCCCTCTGGCAAAGATGGCTCTAATGGAATCCCTGGCCCCATCGGG
CCTCCAGGTCCCCGTGGA(c/t)GCTCAGGAGAAACAGGCCCTGTTGTAAGTGTCCTGACCCCACCCCACCCTCCCC
CTTCCACCATCGGAGGTATCCCCAGCATTTTATAGGGCCTTTGGAACATCAGCTGAGGTCACAGGGCTCATGAGGG
GTTCTGGGAAACAGAAGAGCCAGGGA
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
11433 | CTC CAG GTC CCC GTG | SEQ | ||||
17738 | GGC AAA GAT GGC TCT AAT GGA | Forward | ||||
17739 | Fluorophore | TGG CCC TCA GTC TGT AGG ATG | Reverse |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.00 |
MgCl2 | 2.00 |
dNTPS-kapa | 0.20 |
17738 | 0.50 |
17739 | 0.50 |
Glycerol | 5.00 |
Kapa 2G HS taq polym | 0.01 |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |