Stock No: 003913
Protocol 40801: Sanger sequencing Assay - Npr2<cn>
Version 1.0

Notes

>chr4:43648242+43648533 292bp GCCTCGATGGACTAGTTTGC GAACACTAGGACGCTGGAGAA

Mut = G

WT= T

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

gcctcgatggactagtttgctctagagctcttttgtctttcagcttgagaattttttaggaacttgggcactaatttcagagcctctgctttcccgtcctgttagGTGGTGACAC(t/g)TCTTAATGACCTTTATACCTGCTTTGATGCCATTATCGACAACTTTGATGTCTACAAGgtgagagctggagctgacctccttctaagacccatttcaaacccagtttcctgaaccccacagaccttatccactccacagtcagcgctccctaagtttctccagcgtcctagtgttc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
56811 GCC TCG ATG GAC TAG TTT GC Forward A
56812 GAA CAC TAG GAC GCT GGA GAA Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
56811 0.50 uM
56812 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
003913 C;STOCK Npr2cn/J
000294 STOCK Npr2cn/J
2 strains use this protocol