For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 003829
Protocol 31760: Standard PCR Assay - Tg(Wnt1-GAL4)11Rth-Chr11
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 198 bp
Heterozygote = 198 bp and 255 bp
Wild type = 255 bp
Heterozygote = 198 bp and 255 bp
Wild type = 255 bp
>chr11:6425396-6425650 255bp AGGCATGTGTTTCCCTTCTG GAGTCCAGGTCCTCTGGTTG
This assay may be capable of distinguishing hemi from hom. Transgene integration site is known to be on mouse Chr 11.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for transgene copy number evaluation. If this is required, it is suggested to type by qPCR.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37574 | AGG CAT GTG TTT CCC TTC TG | Wild type Forward | mChr11 | |||
| 37575 | GAG TCC AGG TCC TCT GGT TG | Common | mChr11 | |||
| 37579 | CTC TTC CGG AGG AAA ATG TC | Transgene Forward | GAL4 |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| Primer 1 | 0.50 uM |
| Primer 2 | 0.50 uM |
| Primer 3 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.