Stock No: 003771
Protocol 31998: Probe Assay - Tg(Nes-cre)1Kln-Chr12-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  87 bp

Wild Type = 93 bp

>chr12:91763004+91763096 93bp CATAATAAATTGTTCACTCTCAAAGG CCAGAGCTGTGATTTGTAATTCT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
38146 CAT AAT AAA TTG TTC ACT CTC AAA GG Wild type Forward A
38147 CCA GAG CTG TGA TTT GTA ATT CT Common A
38148 Fluorophore-1 CCA ACA CCA TGG AAT AGG TTT C Quencher-1 WT Probe
38149 GTT CTT GAG TAG TGC GTC ATC G Mutant Forward A
38150 Fluorophore-2 TGT GAG TTT GTG TCG AAT AGG TTT C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
38146 0.40 uM
38147 0.40 uM
38149 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.