Stock No: 003605
Protocol 12209: Sanger sequencing Assay - Cln6<nclf>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

ctgccctgctaaggaactcacaacttccagagggactttctatcccgtttttttttctgagggaagggttatcacacatcgtaattgaggcaggggcatgccatggccctcattcttcacctcagCTTATTGAGCGGTCCCCCc/-GAACGCTG

CCGCGGTCTATAGTCTATGTCAGCATCATCACTTTCATCATGGGAGCCAGCATCCACCTGGTGGGAGACTCAGTCAACCATCGCCTGCTCTTCAGTGGGTACCAGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
20349 CTG CCC TGC TAA GGA ACT CA Forward
20350 GCT GGT ACC CAC TGA AGA GC Reverse

Reaction A

Component Final Concentration
ddH2O
High Fidelity Buffer 1.00
dNTP 0.05
MgSO4 1.00
Platinum Taq Pol. 0.02
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 55.0 --
4 68.0 --
5 -- Go to step 2-4, 35 times
6 68.0 --
7 4.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.