Stock No: 003598
Protocol 22924: Standard PCR Assay - Htt<tm5Mem>
Version 2.3

Notes

AM Bufer: 670 mM TrisHCl pH 8.8, 166 mM (NH4)2SO4, 20 mM MgCl2, 1.7 mg/ml BSA, 10 mM 2-mercaptoethanol (Add 2-mercaptoethanol to 10 mM just prior to use. Do not store with 2-mercaptoethanol in buffer.)

 

Primer oIMR1610 may have a nucleotide mismatch depending on which reference genome it is being compared to:

GTCCTGACATCGGGAAAGAG or GTCCTGACTTCGGGAAAGAG
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 694 bp
Heterozygote = 424 bp and 694 bp
Wild type = 424 bp
Separated by gel electrophoresis on a 1.5% agarose gel.**

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
oIMR1610 GTC CTG ACA TCG GGA AAG AG Common A, B
oIMR1611 GTT CCT CTG CCG GAC CTG Wild type B
oIMR6533 GGC TGA GGA AGC TGA GGA G A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
oIMR1610 0.50 uM
oIMR6533 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
oIMR1610 0.50 uM
oIMR1611 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
003598 B6.129-Htttm5Mem/J
003456 STOCK Htttm5Mem/J
2 strains use this protocol