Protocol 19554: Probe Assay - Tg(Alb-cre)21Mgn-Chr13 Alternate2
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  175 bp

Wild Type = 178 bp

This assay is capable of distinguishing hemi from hom.

Sequence

Wt Sequence:

ccagggcaaaacctcaaaactctgtactggacatttctcaaggccaggtcaatgcaaacatcacatgcacacggtttggaagtgctgccctacaagggctCTGActcaacccattttagacataatagttgactttgaccttcaaattgacagg

tcctatgtgaaacataaagattttggaatttcagaagattaacaaacgtagcatacagaacaaaatatggtgcacgatcagcatcaccctgttctgagtcaagatttttg

 

Mutant Sequence:  ATCAAAGAAGTAAGCTCCACCTTAGAAAAAAGTGGAACGTCATGCTAaggACTCAACCCATTTTAGACATAATAGTTGACTTTGACCTTCAAATTGACAGGTCC

TATGTGAAACATAAAGATTTTGGAATTTCAGAAGATTAACAAACGTAGCATACAGAACAAAATATGGTGCACGATCAGCATCACCCTGTTCTGAGTCAAGATTTTTGTTTTGTTTTGTT

TTGTTTTgttttgttttgttttgttttgttttgttttatatccatggctggcaggcatattag

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
20239 TGC AAA CAT CAC ATG CAC AC Wild type Forward A
28843 CGT GCA CCA TAT TTT GTT CTG T Common A
28844 CAA AGA AGT AAG CTC CAC CTT AGA Mutant Forward A
28845 Fluorophore-1 CCT ACA AGG GCT CTG ACT CAA CC Quencher-1 WT Probe
28846 Fluorophore-2 AAA GTG GAA CGT CAT GCT AAG GA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
20239 0.40 uM
28843 0.40 uM
28844 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
003574 B6.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J
018961 B6N.Cg-Speer6-ps1Tg(Alb-cre)21Mgn/J
2 strains use this protocol