Stock No: 003548
Protocol 13397: Pyrosequencing Assay - Ins2<Akita>
Version 4.0

Notes

This genotyping assay uses pyrosequencing technology and is run on the Biotage PSQ 96MA. The Jackson Laboratory is not posting the complete details of our pyrosequencing genotyping assays as the primers for pyrosequencing cannot be used for sequencing using more traditional methods. The wild type and mutant nucleotides and the flanking DNA sequence are provided below.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T/T
Heterozygote = C/T
Wild type = C/C

Sequence

GCTCTTCTCTATCCAGCTAGAAGCATCAGGGGTGGGGGTCATGATCCTCCCGGACAACT
CAGGGTGGGGGTTATGGGCTACCTGACGGTATTGGTTATCTTGGGGAAAGGAACTGTCT
ATGTTCCAGGTTTGGTCTAACAGGTACCTGTGGGAGGTGCCCAGGGAGCCAGGAGAAA
ACTGGGGATGCAGAGGGAACCAAAGAAGTCTTGGGTAGATCTTTTAGGGGCTATTGTGG
CTAGGCAGATAGATAGATTAAGCTGTGGCTACCCTACCAGCCCCACTCATGTCTCCTGGT
CCCACATATGCACATGCACATACACACACAACTTGTGCTCATTCAAAGGTTTTATTCATT
GCAGAGGGGTAGGCTGGGTAGTGGTGGGTCTAGTTGCAGTAGTTCTCCAGCTGGTAGA
GGGAGCAGATGCTGGTG(C/T)AGCACTGATCTACAATGCCACGCTTCTGCTGGGCCACC
TCCAGTGCCAAGGTCTGAAGGTCACCTGCTCCCGGGCCTCCACCCAGCTCCAGTTGTG
CCACTGCCAGGGAGGTTGTGTCAGAGCAGGCCAGGGCATCAGCAGCACAGAAGCAAA
GACACATAGGAAAATCCAGTCAGGAGTAGCTGAGCAACCTCCTACTACCCCAGGTTTTC
TCGCCCCTTAACCCCTGCAGGTGGCAGGGGTTGCATGCCTGTGGGACAAGTCACTGGTC
ATGGATGGACACATGGGCCTCTAAAGCCTACTCATCTTCAGTCAGTGCAGTGCTCTATGA
GGGCCCTAAATAGGTACCTATCCTGGGATCTAGTCACATGTCCCAAGTTACTACCACCAA
GGACCCCTTAAGGCAGGATTCTTACTCATTCCTGGCAGCTGCCATGTTTACATATGTCTAG
CTTCCCCCAGAAACGTGTCCCCACTCCCTGGTTATCCCGAGACCCTCCACACCTAGGACA
CAATTTACAATGTCCCAAGTGTGAAGAAAACCAGGGTAGTTAGCACTGGGGACAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
poIMR0041 TGG GTC TAG TTG CAG TAG TTC TCC
poIMR0042 Fluorophore GAA GCG TGG CAT TGT AGA TCA GT
poIMR0043 GAG CAG ATG CTG GTG

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.00
MgCl2 2.00
dNTPS-kapa 0.20
poIMR0041 0.50
poIMR0042 0.50
Glycerol 5.00
Kapa 2G HS taq polym 0.01
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
006580 B6.Cg-Ins2Akita Ldlrtm1Her/J
003548 C57BL/6-Ins2Akita/J
008659 NOD.Cg-Rag1tm1Mom Ins2Akita Prf1tm1Sdz/SzJ
014568 NOD.Cg-Rag1tm1Mom Ins2Akita Il2rgtm1Wjl/SzJ
4 strains use this protocol