Protocol 30813: Probe Assay - Hba<tm1Paz> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  85 bp

Wild Type = 113 bp

>chr11:32183302+32183417 116bp CAGAAGCAGGTTGTGGTTGA CCTACCTTGGTCAGAGAAGCA

Sequence

Wt Sequence: aagctgaccttaaactactgggctcaagcagtcttcttgcctcagcctaccaggaccagaggctccccatatgtgtcaccaaaaccagctcagagcatttccttattgatccatgGTagcacagggcagctaagatgcaagtctgaaggaggagtctggcgagctgctcctgcagttccctggacccagaaggatgagctagcagattcacttgagccaaaggattccaggccagcctggaaactagagcaagacctgctcacataaaaagaggaaaaggagaaagagggaaaagacaagaaaggaggagccaggggaggagacagtggacaaagaggaagagagaggaaagaggggagaaaagagagaaagagagtgtctctatggggtgctagcatcttatcctactttatttcatatccaggggctggggctgaggcCAGAAGCAGGTTGTGGTTGagaaaggaaagtgtgaaacagggacccagagggagaggtggggggatgggcgctgctcagtttggtttgagggacttgcttctctgaccaaggtaggaggatac

 

Mutant Sequence: TGCTTCTGTTATAAAAATGGGGTCTCTCTTTGCAGAAGCTGACCTTAAACTACTGGGCTCAAGCAGTCTTCTTGCCTCAGCCTACCAGGACCAGAGGCTCCCCATATGTGTCACCAAAACCAGCTCAGAGCATTTCCTTATTGATCCATGGgacgtcgacctgaggtaattataacccggGCCCTATATATGGATCCAAT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35572 GTG TCA CCA AAA CCA GCT CA Mutant Forward A
35573 CAT ATA TAG GGC CCG GGT TA Mutant Reverse A
35575 Fluorophore-1 TGG GAC GTC GAC CTG AGG TAA T Quencher-1 MUT Probe
35577 Fluorophore-2 CAG GGA CCC AGA GGG AGA GG Quencher-2 WT Probe
35578 CAG AAG CAG GTT GTG GTT GA Wild type Forward A
35579 CCT ACC TTG GTC AGA GAA GCA Wild type Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
35572 0.40 uM
35573 0.40 uM
35578 0.40 uM
35579 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.