Protocol 21979: End Point Analysis Assay - Hbb<tm1Tow>-PROBE
Version 4.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

MUT = 164bp

WT = 98bp

Sequence

Mutant sequence, including the junction:
 
(gagactagtgagacgtgctacttccatttgtcacgtcctgcacgacgcgagctgcggggcgggggggaacttcctgactaggg
gaggagtagaaggtggcgcgaaggggccaccaaagaacggagccggttggcgcctaccggtggatgtggaatgtgtgcgag
gccagaggccacttgtgtagcgccaagtgcccagcggggctgctaaagcgcatgctccagactgccttgggaaaagcgcctc
ccctacccggtagaattcctgcagcccggg)GGATCCTGAGAACTTCAGGGTGAGTCTGATGGGCACCTCC
TGGGTTTCCTTCCCCTGGCTATTCTGCTCAACCTTCCTATCAGAAGGAAAGGGGAAGCGATTCTAGGGAGCA
GTCTCCATGACTGTGTGTGGAGTGTTGACAAGAGTTTGGATATTTTATTCTCTACTCAGAAT
CGCTGCTCCCCCTCACTCTGTTCTGTGTTGTCAT
 
WT Hbb, including junction:
 
(ctgctggttgtctacccttggacccagcggtactttgatagctttggagacctatcctctgcctctgctatcatgggtaatgccaaagtgaaggcccatggcaagaa
agtgataactgcctttaacgatggcctgaatcacttggacagcctcaagggcacctttgccagcctcagtgagctccactgtgacaagctgcatgt)GGATCC
TGAGAACTTCAGGGTGAGTCTGATGGGCACCTCCTGGGTTTCCTTCCCCTGGCTATTCTGCTCAACC
TTCCTATCAGAAGGAAAGGGGAAGCGATTCTAGGGAGCAGTCTCCATGACTGTGTGTGGAGTGTTG
ACAAGAGTTTGGATATTTTATTCTCTACTCAGAATCGCTGCTCCCCCTCACTCTGTTCTGTGTTGTCA
T

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
19726 CAG ACT CAC CCT GAA GTT CTC Common A
19727 CGG TGG ATG TGG AAT GTG T Mutant Reverse A
19728 Fluorophore-1 CTT GTG TAG CGC CAA GTG CCC Quencher-1 MUT Probe
19729 TGA ATC ACT TGG ACA GCC TC Wild type Forward A
19730 Fluorophore-2 ACC TTT GCC AGC CTC AGT GAG C Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
19726 0.40 uM
19727 0.40 uM
19729 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.