Genotyping Protocols Database
Protocol 33918: QPCR Assay - Generic HPRT qPCR
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Tg=  70 bp

IPC = 74 bp

Sequence

Tg Sequence: CTCAACTTTAACTGGAAAGAATGTCTTGATTGTGGAAGATATAATTGACACTGGCAAAACAATGCAGACTTTGCTTTCCTTGGTCAGGCAGTATAATCCAAAGATGGTCAAGGTCGCAAGCTTGCTGGTGAAAAGGACCCCACGAAGTGTTGGATATAAGCCAGACTTTGTTGGATTTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCA

 

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37840 ACA CTG GCA AAA CAA TGC AG Transgene Forward A
37841 GCG ACC TTG ACC ATC TTT G Transgene Reverse A
37842 Fluorophore-1 CTT TGC TTT CCT TGG TCA GGC AG Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
37840 0.40 uM
37841 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Tg Probe 0.15 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
002683 B6.129P2-Hbb-b1tm1Unc Hbb-b2tm1Unc/J
003253 B6;129P2-Hbb-b1tm1Unc Hbb-b2tm1Unc/J
003250 B6;129P2-Hbbtm2Unc/J
002788 B6;129S7-Fsttm1Zuk/J
002990 B6;129S7-Inhbatm1Zuk/J
003119 STOCK Sp4tm1Ssp/J
028287 STOCK Tg(CD207-cre/ERT2)1Dhka/J
7 strains use this protocol