For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 003147
Protocol 21981: End Point Analysis Assay - Hc<1>/Hc<0>
Version 3.0
Notes
Mutant allele is Hc<0> and is a 2-base TA deletion. It is found in A/HeJ, AKR/J, DBA/2J, NZB/B1NJ, SWR/J, B10.D2/oSnJ. JR000461. HOM controls are available from DNA resource.
Wild type allele is Hc<1> and is found in BALB/cJ, C57BL/6J, DBA/1J, and B10.D2/nSnJ. JR000463
also have a pyro assay that works well. KC 9-20-12
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant allele is Hc<0> and is a 2-base TA deletion. It is found in A/HeJ, AKR/J, DBA/2J, NZB/B1NJ, SWR/J, B10.D2/oSnJ. JR000461
Wild type allele is Hc<1> and is found in BALB/cJ, C57BL/6J, DBA/1J, and B10.D2/nSnJ. JR000463
Sequence
ttagaagtatttaatgacattcgtgtttttaaatattttgcttccacagGTATGGTGTTTG
GACAATTAAAGCTAACTATAAGAAGGATTTTACAACAACTGGAACTGCA[ta]CTTTGAAAT
TAAAGAATATGgtaatctctaatattaatatattattataactaagagggattttgcagt
acctttggtatgactggaagtaccagaaga
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 15123 | TCC ACA GGT ATG GTG TTT GG | Forward | A | |||
| 15124 | CCA AAG GTA CTG CAA AAT CC | Reverse | A | |||
| 15125 | Fluorophore-1 | ACT GGA ACT GCA TAC TTT GAA ATT AA | Quencher-1 | WT Probe | ||
| 15126 | Fluorophore-2 | ACT GGA ACT GCA CTT TGA AAT TAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 15123 | 0.40 uM |
| 15124 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 027528 | B10.Cg-H2d Tg(Alb1-HBV)66Bri/ChiJ |
| 003147 | B10.Cg-Hc1 H2d H2-T18c Tg(DO11.10)10Dlo/J |
| 000460 | B10.D2-Hc0 H2d H2-T18c/o2SnJ |
| 000461 | B10.D2-Hc0 H2d H2-T18c/oSnJ |
| 000463 | B10.D2-Hc1 H2d H2-T18c/nSnJ |
| 034608 | J:ARC(S) |
| 004306 | NOD.CBALs-Hc1/LtJ |
| 030511 | NOD.Cg-Hc1 Prkdcscid Il2rgtm1Wjl/SzJ |
| 8 strains use this protocol | |