For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 003118
Protocol 21960: End Point Analysis Assay - Foxn1<nu>
Version 4.0
Notes
TGS Design, KC 12/20/11.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
MUT = GG
WT = GGG
amplicon = 128 bp
Sequence
Foxn1 genomic
CTTCCGCCTTTCTCCTTCAGAAAAGTATCCTGGCTTTGGCTTTGAGGAGGGC
CCAGCAGGCAGCCCA(ggg)CGCTTCCTCAAGGGCAACCACATGCCTTTCCACC
CCTACAAGAGGCACTTCCATGAGG
Mutant has 2 G's in indicated location, Wild type has 3 G's.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 13775 | CTT CCG CCT TTC TCC TTC AG | Forward | A | |||
| 13776 | CCT CAT GGA AGT GCC TCT TG | Reverse | A | |||
| 13777 | Fluorophore-1 | CAG CCC AGG CGC TTC | Quencher-1 | MUT Probe | ||
| 13778 | Fluorophore-2 | CAG CCC AGG GCG CTT C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 13775 | 0.40 uM |
| 13776 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.