Stock No: 003011
Protocol 14301: Pyrosequencing Assay - Slc9a1<swe>
Version 4.0

Notes

This genotyping assay uses pyrosequencing technology and is run on the Biotage PSQ 96MA. The Jackson Laboratory is not posting the complete details of our pyrosequencing genotyping assays as the primers for pyrosequencing cannot be used for sequencing using more traditional methods. The wild type and mutant nucleotides and the flanking DNA sequence are provided below.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T/T
Heterozygote = A/T
Wild type = A/A

Sequence

agttcaaactcagtaccaggattgtttcctccagtcccttgacctgtaccccgtgaaggcctctgggatattcagaacaaatgcaggttgaggaa
ccctttaaagacctaccaaggttttggatgagtgagctggagttcctgggctgcg ggacccaggaaccgagtgagctggttggac
ggttggacgtagtgggaggagcttcctggaccgcctgacctctcctccgcctgctccctggcaggtgtcctggtcctgacctggttcatca
ac(a/t)agttccgcattgtcaagctgacccccaaggaccagttcatcattgcctatgggggcctgcgaggggccatcgccttctcgctgg
gctacctcctggacaagaagcacttccccatgtgtgacctgttcctcaccgccatcatcaccgtcatctttttcaccgtctttgtgcaggtg ct
gggcctggggtgggcagacccctgcctgggggccccgacttttgtggtagaaaaaaaaaaggctgtgggcatgctgtcactagctt
gccgcatgactttgggcaagccgtccccctttgaggcctcagttctcagctgtgacaatgag aagtcaatcagtatatgaagtg
acgaatgttgcccaacttgagtaagagccactggagtgacgtgggtagcagccggcaggcccaagatctactgccccatcatggtag
ggctgagtggcatcatggtttagcatctgcagcagttcagcataggcggccggacagtctcctgagtcaggaaggcctggactcagcc
taacgttctactagctgtttcctgggaaggcgtgcctgtctgcagtgaggagtcggggctagctggttacagcccctacagcctgctggcccatgacttctgg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
poIMR0026 CGT GAA GGC CTC TGG GAT A
poIMR0027 Fluorophore GAA CTG GTC CTT GGG GGT CA
poIMR028 TGA CCT GGT TCA TCA A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.00
MgCl2 2.00
dNTPS-kapa 0.20
poIMR0026 0.50
poIMR0027 0.50
Glycerol 5.00
Kapa 2G HS taq polym 0.01
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
003012 B6.SJL-Slc9a1swe/J
003011 SJL/J-Slc9a1swe/J
2 strains use this protocol