For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 002930
Protocol 32713: End Point Analysis Assay - Tlr4<Lps-d> Alternate 4
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =A/A
Heterozygote = A/C
Wild type = C/C
>chr4:66502105+66502203 99bp CTTTCACCTCTGCCTTCACT ACAATAACCTTCCGGCTCTT
Sequence
GAATGAGGACTGGGTGAGAAATGAGCTGGTAAAGAATTTAGAAGAAGGAGTGCCCCGCTTTCACCTCTGCCTTCACTACAGAGACTTTATTC(C/A)TGGTGTAGCCATTGCTGCCAACATCATCCAGGAAGGCTTCCACAAGAGCCGGAAGGTTATTGTGGTAGTGTCTAGACACTTTATTCAGAGCCGTTGGTGTATCTTTGAATATGAGATTGCTCAAACATGGCAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39333 | Fluorophore-1 | AGA CTT TAT TCC TGG TGT AGC CA | Quencher-1 | WT Probe | ||
| 53782 | Fluorophore-2 | CTT TAT TCA TGG TGT AGC CAT TGC | Quencher-2 | MUT Probe | ||
| 53783 | GCT TTC ACC TCT GCC TTC AC | Forward | A | |||
| 53784 | CCT TCC TGG ATG ATG TTG G | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 53783 | 0.40 uM |
| 53784 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.