For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 002781
Protocol 30591: Standard PCR Assay - Cdkn1b<tm1Mlf> Alternate3
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 199 bp
Heterozygote = 199 bp and 264 bp
Wild type = 264 bp
>chr6:134871328+134871591 264bp GTGGACCAAATGCCTGACTC TCATAAACAGGGCAAGCAGTC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34798 | ACA ACA AGC TGG AAC CCT GT | Mutant Reverse | A | |||
| 34955 | GTG GAC CAA ATG CCT GAC TC | Wild type Forward | A | |||
| 34956 | TCA TAA ACA GGG CAA GCA GTC | Wild type Reverse | A | |||
| 34957 | CAT AGC CTG AAG AAC GAG ATC AG | Mutant Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 34798 | 0.50 uM |
| 34955 | 0.50 uM |
| 34956 | 0.50 uM |
| 34957 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.