Stock No: 002663
Protocol 30637: Probe Assay - Generic Cd4 Probe-alternate3
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  119 bp

Wild Type = 108 bp

>chr6:124822637-124822744 108bp ATCCTTGGGGATGGTGTGT GCTATCCAAGGTCAGGGTCAG

Sequence

Wt Sequence: atccttggggatggtgtgtgatgcaggtactctgcttcctctacagTGACCTTCAGTCCGggTACCAGCCTGTTGCAAGGGCAGAGCCTGACCCTGACCTTGGATAGC

 

Mutant Sequence: gtgttgggtcgtttgttcggatccgtcgactagaGTACCAGCCTGTTGCAAGGGCAGAGCCTGACCCTGACCTTGGATAGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
33568 Fluorophore-1 CTG CTT CCT CTA CAG TGA CCT TC Quencher-1 WT Probe
33569 ATC CTT GGG GAT GGT GTG T Wild type Forward A
35069 GCT ATC CAA GGT CAG GGT CAG Common A
35070 Fluorophore-2 TCG TTT GTT CGG ATC CGT C Quencher-2 MUT Probe
oIMR8394 AGG GGA TCG GCA ATA AAA AG Mutant Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
33569 0.40 uM
35069 0.40 uM
oIMR8394 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
002663 B6.129S2-Cd4tm1Mak/J
032564 FVB.129S2(B6)-Cd4tm1Mak/LcsnJ
2 strains use this protocol