Stock No: 002561
Protocol 35038: End Point Analysis Assay - Nek8<jck>-EP
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T, T

Wild type = G, G

>chr11:77982518-77982630 113bp AGGAGGCAAATCCTTCACTT AGGGCCAGCACATGAGAG

Sequence

TGGAGTTAAAGAGACAGTTACCTTCTGAGAATTTGCAGCCTCCAACTTCCGGCTTGCA
GGGGAGGGGACTCAGACCATGGTAGGAGGCAAATCCTTCACTTTTTTTTTTTCTTTCT
CTAGCCCACCATTGTAGAAGCCTTGCT(g/t)G(g/t)CTATGAGATGGTGCAGGT
GGCCTGTGGGGCCTCTCATGTGCTGGCCCTGTCCACAGATGGAGAGTTATTCGCCTGG
GGCAGAGGAGATGGTGGTAAGCCCACTGCCCAGCTCCAGTGTTTAGGGTCCCTCTCA
CAACTTCTCCATCATGCTTTGTTCATTCCTAT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45099 AGG AGG CAA ATC CTT CAC TT Forward A
45100 AGG GCC AGC ACA TGA GAG Reverse A
45101 Fluorophore-1 AGC CTT GCT GGG CTA TGA GAT Quencher-1 WT Probe
45102 Fluorophore-2 AAG CCT TGC TTG TCT ATG AGA TG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45099 0.40 uM
45100 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.