Stock No: 002547
Protocol 37953: Probe Assay - Trp53<tm1Tyj>-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:69589085+69589199 115bp GGTCACCTGTAGTGAGGTAGGG CCCATGCAGGAGCTATTACAC

Mut= 153 bp

Wt= 115 bp

Fam=Mut

Hex=Wt

Sequence

Wt Sequence:

ggctgctgcaggtcacctgtagtgaggtagggagcgacttcacctggatcctgtgtcttcccccagGCCGGCTCTGAGTATACCACCATCCACTACAAGTACATGTGTAATAGCTCCTGCATGGGGGGCATG

Mutant Sequence:

TCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTGACTCTAGAGGATCCTGTGTCTTCCCCCAGGCCGGCTCTGAGTATACCACCATCCACTACAAGTACATGTGTAATAGCTCCTGCATGGGGGGCATGAACCGCCGACCTATCCTTACCATCATCACACTGGAAGACTCCAGGTAGGAAGGCGCGTGGTAGGTTAGGTTAGCCTGTTTCTTCCCCAGCTTCTGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52606 GGT CAC CTG TAG TGA GGT AGG G Wild type Forward A
52607 CCC ATG CAG GAG CTA TTA CAC A Common A
52608 CCT CTG TTC CAC ATA CAC TTC A Mutant Forward A
52609 Fluorophore-1 AGC GAC TTC ACC TGG ATC C Quencher-1 WT Probe
52610 Fluorophore-2 CCA TCA GAA GCT GAC TCT AGA GGA TCC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00
Kapa Probe Fast QPCR 1.00 X
ddH2O
ddH2O
Primer 0.42
52606 0.40 uM
Primer 0.42
52607 0.40 uM
Primer 0.42
52608 0.40 uM
Primer 0.42
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA
Probe 0.17
Probe 0.17
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
002080 129-Trp53tm1Tyj/J
008651 129S-Trp53tm3Tyj/J
008192 B6.129S2-Nf1tm1Tyj/J
002101 B6.129S2-Trp53tm1Tyj/J
027678 B6;129-Trp53tm1Tyj Nf1tm1Tyj Suz12Gt(Betageo)1Khe/KcichJ
008191 B6;129S2-Trp53tm1Tyj Nf1tm1Tyj/J
002103 B6;129S2-Trp53tm1Tyj/J
002526 C.129S2(B6)-Trp53tm1Tyj/J
002547 C3Ou.129S2(B6)-Trp53tm1Tyj/J
002899 FVB.129S2(B6)-Trp53tm1Tyj/J
017530 STOCK Igs2tm2(ACTB-tdTomato,-EGFP)Luo Trp53tm1Tyj Nf1tm1Par/J
11 strains use this protocol