Stock No: 002391
Protocol 21932: End Point Analysis Assay - Cpe<fat>End Point
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = C/C
Heterozygote = T/C
Wild type = T/T

Sequence

gagcagtctctcttgctttctttgtcttttctgtgacatcaccagtggcgattgtcagcttct
gagtcttgtgatctttcctctttgaaacagCTTGCCCCCGAGACCAAGGCTGTCATTCACTGG
ATCATGGACATTCCATTTGTGCTT(t/c)CTGCCAATCTGCACGGAGGAGACCTTGTGGCTAAT
TACCCATATGATGAGACACGGAGCGgtaggtagtccccacttcctgccccctttaagtggctt
aagtcaaaaatgacagcacgatttctgtatgag

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14942 ACC AAG GCT GTC ATT CAC TG Forward A
14943 GGT AAT TAG CCA CAA GGT CTC C Reverse A
14944 Fluorophore-1 ATT TGT GCT TTC TGC CAA TCT Quencher-1 WT Probe
14945 Fluorophore-2 ATT TGT GCT TCC TGC CAA TCT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14942 0.40 uM
14943 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
003713 B6.CAST-Cpe+/J
003923 B6.HRS(BKS)-Cpefat/J
002391 BKSChpLt.HRS-Cpefat/J
003774 CAST.HRS(BKS)-Cpefat/Jng
4 strains use this protocol