Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 100 bp
Wild Type = 130 bp
Wt Sequence:gatctctgtgagttcaaggccagcgtggtctacagagggaaagtagcaagtttcaggatatCCAGggctacagaatagagagactctgtcttcaagaaaatgaattaaattaattaaaatgtttaaagttatgtgttttca
ccttcctaattttctttttaaaaatttattttatccagctgggcaatgtagcacatgcc
Mutant Sequence: GCCAGCGTGGTCTACAGAGGGAAAGTAGCAAGTTTCAGgatatccagtgaaagaccccTTCATAAGGCTTAGCCAGCTAACTGCAGTAACGCCATTTTGCA
AGGCATGGGAAAATACCAGAGCTGATGTTCTCAGAAAAACAAGAACAAGGAAGTACAGAGAGGCTGGAAAGTACCGG
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
31314 | AGA AAA TTA GGA AGG TGA AAA CAC A | Wild type Reverse | A | |||
31588 | GGT CTA CAG AGG GAA AGT AGC A | Common | A | |||
31589 | CAT GCC TTG CAA AAT GG | Mutant Reverse | A | |||
31590 | Fluorophore-1 | ATA TCC AGG GCT ACA GAA TAG AGA GA | Quencher-1 | WT Probe | ||
31591 | Fluorophore-2 | TCC AGT GAA AGA CCC CTT CAT A | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTP KAPA | 0.26 mM |
31314 | 0.50 uM |
31588 | 0.50 uM |
31589 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |