Genotyping Protocols Database
Stock No: 002282
Protocol 21987: End Point Analysis Assay - Itpr3<tf>End Point
Version 4.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 12 nucleotides absent

Wild type = 12 nucleotides present

Sequence

gaggactgactgttctgttttgttccaatgccttggagcatcctgagtggctggatgctagag
cccatttaagggttccttcacccatcttggagcagcagggctcctgatggagactgttcttca
catcacctctgtttgtctagTTCATCCTGAACGTACGC[ttagactaccgc]ATCTCCTACCTGTTGT
CGGTCTTCAAGAAGGAGTTTGTGGAGGTGTTTCCCATGCAGGACAGCGGGGCGGACGGCACGG
CACCTGCCTTTGATTCCTCCAgtaagccttgacccctagcatctact

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
15847 GGT TCC TTC ACC CAT CTT GG Forward A
15848 ACA CCT CCA CAA ACT CCT TC Reverse A
15849 Fluorophore-1 GTA CGC TTA GAC TAC CGC ATC TCC Quencher-1 WT Probe
15850 Fluorophore-2 TGA ACG TAC GCA TCT CCT ACC T Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
15847 0.40 uM
15848 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.