Genotyping Protocols Database
Stock No: 001924
Protocol 31415: Probe Assay - Pde6b<rd1> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  79 bp

Wild Type = 94 bp

>chr5:108819412+108819505 94bp TGTGGCCTCAAAGATACATCC GGATCAATACAAACCTGCACAAC

Sequence

Wt Sequence: ctacccatgtcctacagcccctctccaaggtttataGTcactctgtggcctcaaagatacatcctTGgtggcacatcatgtctactactgttatgatgattctgtgacctgcaggttgtgcaggtttgtattgatcccagactgagggaaaaggagtaaccgtcaaagtcagcaaaatccatatttccaccagtggcatcaggacactctgcatcgccaaggacagaata

 

Mut Sequence:

TTATAGTCACTCTGTGGCCTCAAAGATACATCCTTtgaaagacccccgaggtgggtagtcaatcaatctgaggagaccctcccaaggatcagcgagaccacgattcggatgtaaacagcaagaggctttattgggaacacgggtacccgggcgactcagtctgtcggaggactggcgcgccgagtgtggggtttttaccctttttatagggctggggagcaaaaagcgt

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
36815 TGT GGC CTC AAA GAT ACA TCC Common A
36816 TGA TCC TTG GGA GGG TCT C Mutant Reverse A
36817 GGA TCA ATA CAA ACC TGC ACA AC Wild type Reverse A
36818 Fluorophore-1 ACC CCC GAG GTG GGT AGT CA Quencher-1 MUT Probe
36819 Fluorophore-2 TGG CAC ATC ATG TCT ACT ACT GTT ATG A Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
36815 0.40 uM
36816 0.40 uM
36817 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000002 B6.C3-Pde6brd1 Hps4le/J
000654 CBA/CaJ
000656 CBA/J
001924 B6EiC3Sn a/A-Ts(1716)65Dn/J
001957 C3A Pde6brd1.O20/A-Prph2Rd2/J
001979 C3A.Cg-Pde6b+ Prph2Rd2/J
003342 STOCK Hbatm1Paz Hbbtm1Tow Tg(HBA-HBBs)41Paz/J
003648 C3Sn.BLiA-Pde6b+/DnJ
004202 B6.C3 Pde6brd1 Hps4le/+ +-Lmx1adr-8J/J
004462 B6C3-Tg(APPswe,PSEN1dE9)85Dbo/Mmjax
004624 FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J
004808 STOCK Mapttm1(EGFP)Klt Tg(MAPT)8cPdav/J
004828 FVB.129P2-Pde6b+ Tyrc-ch/AntJ
004850 B6EiC3Sn-Rb(12.Ts171665Dn)2Cje/CjeDnJ
005441 STOCK Tg(CAG-DsRed*MST)1Nagy/J
006576 B6.FVB-Tg(GNAT2-Dta)98Wwk/J
010815 STOCK Tg(mI56i-flpe)39Fsh/J
022880 FVB.Cg-Pde6b+ Lrrk1tm1.1Mjff Tyrc-ch/J
024703 C3A.Cg-Pde6b+Tg(Thy1-CFP)23Jrs/SjJ
028590 B6C3-Tg(tetO/Prnp-TARDBP*)2Vle/J
031785 FVB.Cg-Pde6b+ Tyrc-ch Mecp2em1Dkatz/J
032909 STOCK Tg(Rho-cre)2Yzl/J
22 strains use this protocol