Genotyping Protocols Database
Stock No: 001924
Protocol 31378: Standard PCR Assay - Generic Pde6b Alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~550 bp
Heterozygote = 318 bp and ~550 bp
Wild type = 318 bp

>chr5:108819374+108819691 318bp CATGTCCTACAGCCCCTCTC ACCATTTGCAAGGAAAGCAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
36758 CAT GTC CTA CAG CCC CTC TC Common A
36759 ACC ATT TGC AAG GAA AGC AC Wild type Reverse A
oIMR2093 AAG CTA GCT GCA GTA ACG CCA TTT Mutant Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
36758 0.50 uM
36759 0.50 uM
oIMR2093 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
000002 B6.C3-Pde6brd1 Hps4le/J
000235 B6C3Fe a/a-Relnrl/J
000654 CBA/CaJ
000656 CBA/J
001924 B6EiC3Sn a/A-Ts(1716)65Dn/J
001957 C3A Pde6brd1.O20/A-Prph2Rd2/J
001979 C3A.Cg-Pde6b+ Prph2Rd2/J
003648 C3Sn.BLiA-Pde6b+/DnJ
004202 B6.C3 Pde6brd1 Hps4le/+ +-Lmx1adr-8J/J
004624 FVB.129P2-Pde6b+ Tyrc-ch Fmr1tm1Cgr/J
004828 FVB.129P2-Pde6b+ Tyrc-ch/AntJ
004850 B6EiC3Sn-Rb(12.Ts171665Dn)2Cje/CjeDnJ
005441 STOCK Tg(CAG-DsRed*MST)1Nagy/J
022880 FVB.Cg-Pde6b+ Lrrk1tm1.1Mjff Tyrc-ch/J
024703 C3A.Cg-Pde6b+Tg(Thy1-CFP)23Jrs/SjJ
15 strains use this protocol