Stock No: 001035
Protocol 5163: End Point Analysis Assay - Napa<hyh>
Version 1.0

Notes

ABI make a Custom SNP assay based on the sequence

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

MUT = A/A

HET  = A/G

WT = G/G

Sequence

Ctgggaatatggctgcctaagggagagggcctccctggaaagatgtgtgcagtatgtctcgtatgcagaaatacccactctgaccaggttgcccggggcctaggtctcccatcctttccttccggttgctctggagatcctaagagccctgaagctaaggcaaccacgtgcctgtcatctccctcagggagtacagtctgcctcctgtcttcaggacctgctataatgacctcttcatcttctctttgctccctagaggccattaactgtctgat[G/A]agagcaattgagatctatacagacatggtaagggttgcttgctgatcctgccttgctctgtcctctcctgtttatgctgtgctttagagggcagggatttgatcgctgagctgagctacagaacggggtgtgtgctgcagcctctgctcatgtcctcatgcacatgctgcctctgtccccttcgtgatccccttgtggctgcagtgtccatgcagtacttcccttgcctggccctcccctgatgtccctaggagcctgagaaatgctcagtctccccctctaggaaggctactatcctgagagacagc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note

Reaction A

Component Final Concentration
PerfeCTa qPCR SuperM UNG, ROX? 1.00 X
Assay Mix (ABI Custo 1.04 X
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 92.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.