Stock No: 001021
Protocol 21959: End Point Analysis Assay - Fasl<gld>
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = G/G
Heterozygote = A/G
Wild type = A/A

 

Sequence

AGTCTTGCAACAACCAGCCCCTAAACCACAAGGTCTATATGAGGAACTCTAAGT
ATCCTGAGGATCTGGTGCTAATGGAGGAGAAGAGGTTGAACTACTGCACTACTG
GACAGATATGGGCCCACAGCAGCTACCTGGGGGCAGTATTCAATCTTACCAGTG
CTGACCATTTATATGTCAACATATCTCAACTCTCTCTGATCAATTTTGAGGAATCT
AAGACC(t/c)TTTTCGGCTTGTATAAGCTTTAAAAGAAAAAGCATTTTAAAATGATC
TACTATTCTTTATCATGGGCACCAGGAATATTGTCTTGAATGAGAGTCTTCTTAAG
ACCTATTGAGATTAATTAAGACTACATGAGCCACAAAGACCTCATGACCGCAAG
GTCCAACAGGTCAGCTATCCTTCATTTTCTCGAGGTCCATGGAGTGGTCCTTAAT
GCCTGCAT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
16633 CTA CCT GGG GGC AGT ATT CA Forward A
16634 CCT GGT GCC CAT GAT AAA GA Reverse A
16635 Fluorophore-1 AAT CTA AGA CCT TTT TCG GCT TG Quencher-1 WT Probe
16636 Fluorophore-2 AAT CTA AGA CCC TTT TCG GCT TG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
16633 0.40 uM
16634 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.