Genotyping Protocols Database
Stock No: 000740
Protocol 35099: QPCR Assay - Yaa Alternate1
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut =  77 bp

IPC = 74 bp

This assay can not differentiate between WT females and Hemi males.

>chrX:167307068-167307144 77bp CAAACTTCTGTAGACCGTCATGG CTCCGTGCATATTCATCGTATC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45267 CAA ACT TCT GTA GAC CGT CAT GG Transgene Forward A Tlr7
45268 CTC CGT GCA TAT TCA TCG TAT C Transgene Reverse A Tlr7
45269 Fluorophore-1 CCC CAG GTC CTT GAG GCC T Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45267 0.40 uM
45268 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Tg Probe 0.15 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000483 B6.SB-Yaa/J
000740 BXSB/MpJ
021330 BXSB.B6-Yaa+/MobJDcrJ
032048 BXSB.129S2(B6)-Ifnar1tm1Agt/DcrJ
4 strains use this protocol