Stock No: 000666
Protocol 21976: End Point Analysis Assay - H2<r>rs33481043-Alternate 1-EP
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

Aggtcgaacgagcctcacacaagtcagaactacatgttcc

Agcatgtatcggaa(T/A)gtaacttccggcgccgtcttttt

ctctcccgtcatgccttgtttacttcc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21920 Fluorophore-1 ATG TAT CGG AAT GTA ACT TCC GG Quencher-1 WT Probe
21922 Fluorophore-2 ATG TAT CGG AAA GTA ACT TCC GG Quencher-2 MUT Probe
22191 AAC GAG CCT CAC ACA AGT CA Forward A
22192 GCA TGA CGG GAG AGA AAA AG Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
22191 0.40 uM
22192 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000457 B10.RIII-H2r H2-T18b/(71NS)SnJ
000666 C57BL/10SnJ
2 strains use this protocol