For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 000661
Protocol 33741: Probe Assay - Clcc1<m1J> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:108661495+108661647 153bp GGTATTTGGGTCTGGGGTCTT GCATGACAGCTAATCCATCG
Mutant= 140 bp
Wild Type = 153 bp
Sequence
Wt Sequence:
Mutant Sequence:
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42099 | GGT ATT TGG GTC TGG GGT CTT | Common | A | |||
| 42100 | GCA TGA CAG CTA ATC CAT CG | Wild type Reverse | A | |||
| 42101 | CAA CTT AGA ACA CAG GAT GTC AGC | Mutant Reverse | A | |||
| 42102 | Fluorophore-1 | TTC GCC GTC ACA AGA TGG | Quencher-1 | MUT Probe | ||
| 42103 | Fluorophore-2 | TGC AGA GCT GTG AGA GTC ACA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42099 | 0.40 uM |
| 42100 | 0.40 uM |
| 42101 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.