Genotyping Protocols Database
Stock No: 000659
Protocol 18454: End Point Analysis Assay - Tlr4<Lps-d>-Alternate 2
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

CCTGTAGAGATGAATACCTCCTTAGTGTTGGATTTTAATAATTCTACCTGTTATATGTACAAGACAA

TCATCAGTGTGTCAGTGGTCAGTGTGATTGTGGTATCCACTGTAGCATTTCTGATATACCACTTC

TATTTTCACCTGATACTTATTGCTGGCTGTAAAAAGTACAGCAGAGGAGAAAGCATCTATGATGC

ATTTGTGATCTACTCGAGTCAGAATGAGGACTGGGTGAGAAATGAGCTGGTAAAGAATTTAGAAG

AAGGAGTGCCCCGCTTTCACCTCTGCCTTCACTACAGAGACTTTATTC[c/a]TGGTGTAGCCATT

GCTGCCAACATCATCCAGGAAGGCTTCCACAAGAGCCGGAAGGTTATTGTGGTAGTGTCTAGA

CACTTTATTCAGAGCCGTTGGTGTATCTTTGAATATGAGATTGCTCAAACATGGCAGTTTCTGAG

CAGCCGCTCTGGCATCATCTTCATTGTCCTTGAGAAGGTTGAGAAGTCCCTGCTGAGGCAGC

AGGTGGAATTGTATCGCCTTCTTAGCAGAAACACCTACCTGGAATGGGAGGACAATCC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14238 Fluorophore-1 GAG ACT TTA TTC ATG GTG TAG CCA T Quencher-1 MUT Probe A
14239 Fluorophore-2 GAG ACT TTA TTC CTG GTG TAG CCA T Quencher-2 WT Probe A
18436 GGA CTG GGT GAG AAA TGA GC Forward A
18437 CCA ACG GCT CTG AAT AAA GTG Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14238 0.40 uM
14239 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
002930 C.C3-Tlr4Lps-d/J
000659 C3H/HeJ
2 strains use this protocol