Stock No: 000643
Protocol 32521: Sanger sequencing Assay - Pou1f1<dw>
Version 1.0

Notes

>chr16:65533733+65534034 302bp CCAACTTCTCCCCTCACACT TGAAAACTGAAAGAAGTGGAGTAGC

Mut = T

WT= G

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

 

GGATGGCTGAAGAACTGAATCTCGAGAAAGAAGTAGTACGAGTGTG(g/t)TTCTGCAACCGAAGGCAGAGAGAAAAACGAGTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39272 CCA ACT TCT CCC CTC ACA CT Forward A
39273 TGA AAA CTG AAA GAA GTG GAG TAG C Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
39272 0.50 uM
39273 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
000772 B6.DW-Pou1f1dw/J
000643 DW/J Mlphln Pou1f1dw/J
2 strains use this protocol