Stock No: 000642
Protocol 30074: End Point Analysis Assay - Dock7<m>-Probe
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = retrotransposon LTR insertion

Sequence

Wild Type Dock7
acataatgatttcaataacagacacgtgtcttttttatttaaagTGGATACCAATGCTGCAG
AATGGACGGTTGAAGACAGGGCAGTTCTGCCTGCCAGTCTCCCTGGAAAAACCACCGCAGGC
TTATTCAGTGCTTTCCCCCGAGgtcagtgccttccagcaag
 
Dock7<m>
ACATAATGATTTCAATAACAGACACGTGTCTTTTTTATTTAAAGTGGATACCAATGCTGCAG
AATGGACGGTTGAAGACCAGTTGCAGAAACGAGGATTATAAAGTAATATGAATGCCCATTGT
AAATTTACTAATGCGTTTGCGATTGTACGAGGGATAGTTAT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14825 AGT GGA TAC CAA TGC TGC AG Common A
14826 TGG TTT TTC CAG GGA GAC TG Wild type Reverse A
14828 GGG CAT TCA TAT TAC TTT ATA ATC CTC G Mutant Reverse A
33838 Fluorophore-1 TCT GCA ACT GGT CTT CAA CCG TCC Quencher-1 MUT Probe
33839 Fluorophore-2 ATG GAC GGT TGA AGA CAG GGC A Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14825 0.40 uM
14826 0.40 uM
14828 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000027 B6.D-Tyrp1b Dock7m/J
000642 BKS.Cg-Dock7m +/+ Leprdb/J
031579 BKS.Cg-Dock7m+/+ Leprdb Tg(SLC2A4)HJdm/PfzrJ
3 strains use this protocol