Stock No: 000642
Protocol 21995: End Point Analysis Assay - Lepr<db>
Version 7.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut=T

Wt=G

Sequence

AGAACGGACACTCTTTGAAGTCTCTCATGACCACTACAGATGAACCCAATCTACC
AACTTCCCAACAGTCCATACAATATTAGAAGATGTTTACATTTTGATGGAGG(g/t)AA
ACAAACCTAAACTATGGTTTGAATGACTAAGAAATAACATTTGATGAGCTTATTAG
AGAAGTGTATATTTTGTGGCCACAATGTAGGTTTGATGTAGTTCAGTTTGGACATAT
GCTTGATTTTCAGGGCATCAAAAATTTA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14349 ACC AAC TTC CCA ACA GTC CA Forward A
14350 TGA TGC CCT GAA AAT CAA GC Reverse A
17934 Fluorophore-1 TTT GAT GGA GGG AAA CAA ACC TA Quencher-1 WT Probe
17935 Fluorophore-2 TTT TGA TGG AGG TAA ACA AAC CTA A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14349 0.40 uM
14350 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
002048 B6 x C57BLKS-Dock7m Leprdb Myo15sh2-J/J
000697 B6.BKS(D)-Leprdb/J
000699 B6.Cg-Dock7m Leprdb/+ +/J
000642 BKS.Cg-Dock7m +/+ Leprdb/J
000700 BKS.Cg-Dock7m Leprdb/+ +/J
031579 BKS.Cg-Dock7m+/+ Leprdb Tg(SLC2A4)HJdm/PfzrJ
008340 BKS.Cg-Leprdb Nos3tm1Unc/RhrsJ
001192 BKS.Cg-meaJ Leprdb +/+ + Dock7m/J
000707 CBA.Cg-Dock7m Leprdb/+ +/J
012666 D2.BKS(D)-Leprdb/J
006654 FVB.BKS(D)-Leprdb/ChuaJ
11 strains use this protocol