For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 000483
Protocol 35099: QPCR Assay - Yaa Alternate1
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = 77 bp
IPC = 74 bp
This assay can not differentiate between WT females and Hemi males.
Yaa males have a piece of the X chromosome translocated on to their Y chromosome. This assay is designed for one of the genes in this X-chromosome piece.
Normal male = 1 copy (from normal X chromosome) = WT
Normal females and Yaa males = 2 copies = WT for the female and hemi for the male
Females will always type as WT.
>chrX:167307068-167307144 77bp CAAACTTCTGTAGACCGTCATGG CTCCGTGCATATTCATCGTATC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45267 | CAA ACT TCT GTA GAC CGT CAT GG | Transgene Forward | A | Tlr7 | ||
| 45268 | CTC CGT GCA TAT TCA TCG TAT C | Transgene Reverse | A | Tlr7 | ||
| 45269 | Fluorophore-1 | CCC CAG GTC CTT GAG GCC T | Quencher-1 | Tg Probe | ||
| oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
| oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
| TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa Probe Fast QPCR | 1.00 X |
| 45267 | 0.40 uM |
| 45268 | 0.40 uM |
| oIMR1544 | 0.40 uM |
| oIMR3580 | 0.40 uM |
| Tg Probe | 0.15 uM |
| IC Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | repeat steps 2-3 for 40 cycles |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.