For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mut = 77 bp
IPC = 74 bp
This assay can not differentiate between WT females and Hemi males.
>chrX:167307068-167307144 77bp CAAACTTCTGTAGACCGTCATGG CTCCGTGCATATTCATCGTATC
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
45267 | CAA ACT TCT GTA GAC CGT CAT GG | Transgene Forward | A | Tlr7 | ||
45268 | CTC CGT GCA TAT TCA TCG TAT C | Transgene Reverse | A | Tlr7 | ||
45269 | Fluorophore-1 | CCC CAG GTC CTT GAG GCC T | Quencher-1 | Tg Probe | ||
oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa Probe Fast QPCR | 1.00 X |
45267 | 0.40 uM |
45268 | 0.40 uM |
oIMR1544 | 0.40 uM |
oIMR3580 | 0.40 uM |
Tg Probe | 0.15 uM |
IC Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | repeat steps 2-3 for 40 cycles |