Stock No: 000461
Protocol 21981: End Point Analysis Assay - Hc<0>
Version 3.0

Notes

Mutant allele is Hc<0> and is a 2-base TA deletion.  It is found in A/HeJ, AKR/J, DBA/2J, NZB/B1NJ, SWR/J, B10.D2/oSnJ.  JR000461. HOM controls are available from DNA resource.

Wild type allele is Hc<1> and is found in BALB/cJ, C57BL/6J, DBA/1J, and B10.D2/nSnJ. JR000463

also have a pyro assay that works well.  KC 9-20-12

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant allele is Hc<0> and is a 2-base TA deletion.  It is found in A/HeJ, AKR/J, DBA/2J, NZB/B1NJ, SWR/J, B10.D2/oSnJ. JR000461

Wild type allele is Hc<1> and is found in BALB/cJ, C57BL/6J, DBA/1J, and B10.D2/nSnJ. JR000463

Sequence

ttagaagtatttaatgacattcgtgtttttaaatattttgcttccacagGTATGGTGTTTG
GACAATTAAAGCTAACTATAAGAAGGATTTTACAACAACTGGAACTGCA[ta]CTTTGAAAT
TAAAGAATATGgtaatctctaatattaatatattattataactaagagggattttgcagt
acctttggtatgactggaagtaccagaaga

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
15123 TCC ACA GGT ATG GTG TTT GG Forward A
15124 CCA AAG GTA CTG CAA AAT CC Reverse A
15125 Fluorophore-1 ACT GGA ACT GCA TAC TTT GAA ATT AA Quencher-1 WT Probe
15126 Fluorophore-2 ACT GGA ACT GCA CTT TGA AAT TAA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
15123 0.40 uM
15124 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
027528 B10.Cg-H2d Tg(Alb1-HBV)66Bri/ChiJ
000460 B10.D2-Hc0 H2d H2-T18c/o2SnJ
000461 B10.D2-Hc0 H2d H2-T18c/oSnJ
000463 B10.D2-Hc1 H2d H2-T18c/nSnJ
030511 NOD.Cg-Hc1 Prkdcscid Il2rgtm1Wjl/SzJ
5 strains use this protocol