Stock No: 000461
Protocol 21971: End Point Analysis Assay - H2-T18<b/c>-EP
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mut = A (c/c)

WT= G (b/b)

 

Sequence

TTGCCTGCTCCAACAGGGACCCATGCATCCAGGG(g/a)TTGAGATACCTTAGGTTCTCATATTCTGCTTCCA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24986 ACA AGG CTA CAG GGC AAA GA Forward A
24987 AGC CTG CTC TGT TTC AGG AG Reverse A
24988 Fluorophore-1 CAT CCA GGG GTT GAG ATA CCT Quencher-1 WT Probe
24989 Fluorophore-2 TGC ATC CAG GGA TTG AGA TAC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
24986 0.40 uM
24987 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
027528 B10.Cg-H2d Tg(Alb1-HBV)66Bri/ChiJ
000461 B10.D2-Hc0 H2d H2-T18c/oSnJ
000463 B10.D2-Hc1 H2d H2-T18c/nSnJ
3 strains use this protocol