For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 000461
Protocol 21971: End Point Analysis Assay - H2-T18<b/c>-EP
Version 2.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut = A (c/c)
WT= G (b/b)
Sequence
TTGCCTGCTCCAACAGGGACCCATGCATCCAGGG(g/a)TTGAGATACCTTAGGTTCTCATATTCTGCTTCCA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24986 | ACA AGG CTA CAG GGC AAA GA | Forward | A | |||
| 24987 | AGC CTG CTC TGT TTC AGG AG | Reverse | A | |||
| 24988 | Fluorophore-1 | CAT CCA GGG GTT GAG ATA CCT | Quencher-1 | WT Probe | ||
| 24989 | Fluorophore-2 | TGC ATC CAG GGA TTG AGA TAC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 24986 | 0.40 uM |
| 24987 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.