For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 000457
Protocol 21976: End Point Analysis Assay - H2<r>rs33481043-Alternate 1-EP
Version 2.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
Aggtcgaacgagcctcacacaagtcagaactacatgttcc
Agcatgtatcggaa(T/A)gtaacttccggcgccgtcttttt
ctctcccgtcatgccttgtttacttcc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 21920 | Fluorophore-1 | ATG TAT CGG AAT GTA ACT TCC GG | Quencher-1 | WT Probe | ||
| 21922 | Fluorophore-2 | ATG TAT CGG AAA GTA ACT TCC GG | Quencher-2 | MUT Probe | ||
| 22191 | AAC GAG CCT CAC ACA AGT CA | Forward | A | |||
| 22192 | GCA TGA CGG GAG AGA AAA AG | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 22191 | 0.40 uM |
| 22192 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.