For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 000287
Protocol 40819: Standard PCR Assay - Eda<Ta>-alternate 1
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 166 bp
Heterozygote = 166 bp and 214 bp
Wild type = 214 bp
X-linked
>chrX:99975525+99975738 214bp GAGGACCTCCTCCCTCATTC CCTCTGCCTCAGTCCTTCAC
The Common F primer (primer 56860) anneals over the nucleotide sequence containing mouse genomic variation rs228176850.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 56860 | GAG GAC CTC CTC CCT CAT TC | Common | A | |||
| 56861 | CCT CTG CCT CAG TCC TTC AC | Wild type Reverse | A | |||
| 56862 | CGC AGA AGA GAA TCC GTC TC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 56860 | 0.50 uM |
| 56861 | 0.50 uM |
| 56862 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.