Protocol 32445: Sanger sequencing Assay - Bmp5<se> Alternate1
Version 1.0

Notes

Mut = T

WT= C

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

ttttataaggagttaacattttctcttcattcctttttttttttcagTTGAAAGAGACAAGG
ACTTTTCTCATCAGAGGAGGCATTACAAAGAGTTTCGGTTTGATCTGACCCAGATTCCACAT
GGAGAAGCAGTGACAGCAGCAGAATTCCGGATTTATAAGGACAAGGGAAACCAT(c/t)GATTT
GAAAATGAAACAATTAAGATCAGCATATATCAGATCATCAAGGAATACACAAACAGgtatc
aactttatattgactatcctaacaaggactgacttttagtaaaaaagccattcatagctta
tgtaatttgcaatacattttcttgaatgaaaggagattctgagccaggt

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
38914 GAA CCA TTT CAC CAG CTC CT Reverse A
39134 GGA GGC ATT ACA AAG AGT TTC G Forward A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
38914 0.50 uM
39134 0.50 uM
Glycerol 6.50 %
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
031329 B6.Cg-+Bmp5se-30DThWb/Myo5adBmp5se/J
000056 B6.Cg-Bmp5se/J
000285 B6.Cg-Rorasg + +/+ Myo5ad Bmp5se/J
000278 B6C3Fe a/a-Papss2bm Hps1ep Hps6ru/J
000253 DLS/LeJ
5 strains use this protocol