For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 000256
Protocol 40841: End Point Analysis Assay - Gusb<mps> EP Alternate2
Version 3.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =-/-
Heterozygote = C/-
Wild type = C/C
chr5:129993523-129993623 101bp GTAAATTCACTCGACCGCTCTT CACCTCCAAATGCCCATAGT
The Fwd primer (primer 56143) anneals over the nucleotide sequence containing mouse genomic variations rs48872564.
The WT & Mut probes anneal over the nucleotide sequence containing mouse genomic variation rs48332902
Sequence
cgaccgctcttgtcttagGCCC(C/-)GTACGTGGATGTTATCTGTGTAAACAGCTACTTTTCTTGGTATCATGAC
TATGGGCATTTGGAGGTGATTCAGCCACAGCTGAATAGCCAGTTTGAGAACTGGTATA
AGACGCATCAGAAGCCGATTATCCAGAGCGAGTATGGAGCAGACGCAATCCCAGGGATCCACGAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 56143 | GTA AAT TCA CTC GAC CGC TCT T | Forward | A | |||
| 56144 | CAC CTC CAA ATG CCC ATA GT | Reverse | A | |||
| 56145 | Fluorophore-1 | TCT TAG GCC CCG TAC GTG GAT | Quencher-1 | WT Probe | ||
| 56929 | Fluorophore-2 | CTT AGG CCC GTA CGT GGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 56143 | 0.40 uM |
| 56144 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 006564 | B6(C)-KitW-41J Gusbmps/BrkJ |
| 006559 | B6.C-H2-Kbm1/ByBir-Gusbmps/BrkJ |
| 000256 | B6.C-H2-Kbm1/ByBir-Gusbmps/J |
| 006562 | B6.CBy(Cg)-Gusbmps Gpi1a-m1J/BrkJ |
| 002086 | B6.Cg-Gusbmps Tg(Gussx)1Wat/J |
| 006407 | B6.Cg-Gusbmps/BrkJ |
| 005053 | NOD.Cg-Prkdcscid Gusbmps/SndsJ |
| 001880 | STOCK Gusbmps Tg(GUSB)4Sly/BirJ |
| 8 strains use this protocol | |