Stock No: 000231
Protocol 32406: Probe Assay - Csf1<op> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 119 bp
Wild Type = 118 bp
>chr3:107556725-107556842 118bp CCTCCTGGTTCCTGTATTCC GTTAGCATTGGGGGTGTTGT
Sequence
gctaacctcctggttcctgtattccagGATGATCCTGTTTGCTACCTAAagaaggcctttttt(-/T)ctggtacaagacataATAGATGAGACCATGCGCTTTAAAGACAACACCCCCAATGCTAACGCCACCGAGAGGCTCCAGGAACTCTC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39024 | CCT CCT GGT TCC TGT ATT CC | Forward | A | |||
| 39025 | Fluorophore-1 | AGG CCT TTT TTT CTG GTA CAA GAC AT | Quencher-1 | MUT Probe | ||
| 39026 | Fluorophore-2 | AGG CCT TTT TTC TGG TAC AAG ACA T | Quencher-2 | WT Probe | ||
| 9998 | Fluorophore-3 | GTT AGC ATT GGG GGT GTT GT | Quencher-3 | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39024 | 0.40 uM |
| 9998 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 4.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.