Genotyping Protocols Database
Stock No: 000231
Protocol 32406: Probe Assay - Csf1<op> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  119 bp

Wild Type = 118 bp

>chr3:107556725-107556842 118bp CCTCCTGGTTCCTGTATTCC GTTAGCATTGGGGGTGTTGT

Sequence

gctaacctcctggttcctgtattccagGATGATCCTGTTTGCTACCTAAagaaggcctttttt(-/T)ctggtacaagacataATAGATGAGACCATGCGCTTTAAAGACAACACCCCCAATGCTAACGCCACCGAGAGGCTCCAGGAACTCTC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
39024 CCT CCT GGT TCC TGT ATT CC Forward A
39025 Fluorophore-1 AGG CCT TTT TTT CTG GTA CAA GAC AT Quencher-1 MUT Probe
39026 Fluorophore-2 AGG CCT TTT TTC TGG TAC AAG ACA T Quencher-2 WT Probe
9998 Fluorophore-3 GTT AGC ATT GGG GGT GTT GT Quencher-3 Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
39024 0.40 uM
9998 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.