For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 000119
Protocol 21989: End Point Analysis Assay - Kit<W-41J>-EP
Version 2.0
Notes
Mut = A
WT= G
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
GAGGTCACAAGGTTTAAGGTCCTCGTCTATCGCTGTCTTCATTAGCTGCTTGAATTTGC
TGTGTTCCGTTCTAGGCACGACTGCCC(g/a)TGAAGTGGATGGCACCAGAGAGCATTTT
CAGCTGCGTGTACACATTTGAAAGTGATGTCTGGTCCTATGGGATTTTCCTCTGGGAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24704 | AGG TCC TCG TCT ATC GCT GT | Forward | A | |||
| 24705 | AAA TGC TCT CTG GTG CCA TC | Reverse | A | |||
| 24706 | Fluorophore-1 | ACT GCC CGT GAA GTG GAT | Quencher-1 | WT Probe | ||
| 24707 | Fluorophore-2 | ACT GCC CAT GAA GTG GAT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 24704 | 0.40 uM |
| 24705 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 039112 | B6.Cg-Ptprca Pepcb KitW-41J Gpi1a/IslabMmjax |
| 000119 | C57BL/6J-KitW-41J/J |
| 026622 | NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ |
| 026497 | NOD.Cg-KitW-41J Prkdcscid Il2rgtm1Wjl/WaskJ |
| 026014 | NOD.Cg-Rag1tm1Mom KitW-41J Il2rgtm1Wjl/EavJ |
| 5 strains use this protocol | |